Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
chr23:5549365-5549645 | |||
Gene | HMGCL | Organism | Chicken |
Genome Locus | chr23:5549365-5549645:n/a | Build | n/a |
Disease | Avian leukosis viral infection | ICD-10 | Viral infection, unspecified (B34.9) |
DBLink | Link to database | PMID | 28415618 |
Experimental Method | |||
Sample Type | Tissues | Comparison | 3 Avian Leukosis Virus subgroup J (ALV-J)-resistant and 3 ALV-J-susceptible chicken |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward CTCCCTGTCTCCTCTCCCAATCTT ReverseCTCTGGTTCCTCTGTACTGCTGTATCC | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
Citation | |||
Zhang, X, Yan, Y, Lei, X, Li, A, Zhang, H, Dai, Z, Li, X, Chen, W, Lin, W, Chen, F, Ma, J, Xie, Q (2017). Circular RNA alterations are involved in resistance to avian leukosis virus subgroup-J-induced tumor formation in chickens. Oncotarget, 8, 21:34961-34970. |